BIOLOGY HIGH SCHOOL

Which of the following is an example of natural resources? (4 points) Factories, good roads, and a large population

Rich soil, forests, and minerals

Automobiles, dairy farms, and governments

Stores, chemical companies, and clothing factories

Answers

Answer 1
Answer: Rich soil, forests, and minerals is your answer

hope this helps
Answer 2
Answer: ..The answer should generally be obvious.
It's B.
This is because forests are renewable; trees grow back over a small period of time. Minerals do as well, and rich soil can earn back its nutrients through time.
Automobiles are not renewable as they give off carbon dioxide, which would be referred to as a greenhouse gas. One that keeps heat in our atmosphere.
Chemical companies dispose of harmful gasses and chemicals that are harmful to our earth, as well as factories.

Related Questions

MIDDLE SCHOOL

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcataactg3’

3’ tcgccctactcgcgtacaccgcgtattgac5’

Answers

This is the DNA. I'm going to only use the upper strand to demonstrate what this strand would code for before and after a single bp deletion (so write it as mRNA). I will also write it how it's easier to see this which is to split them up into the 3 base codon system. Note that you don't need to know the amino acid code - you use a table to find these.

ORIGINAL (mRNA on top, Amino Acid (AA) on bottom:

5'-AGC GGG AUG AGC GCA UGU GGC GCA UAA CUG-3'
    SER  GLY  MET SER ALA  CYS GLY ALA  STOP LEU 

Note that the protein would stop being made at the stop codon and the LEU wouldn't matter at the end...

Now, I will remove one bp...(I bolded it up top). Rewrite the mRNA and find the corresponding AA...

NEW
5'-AGC GGG AUG GCG CAU GTG GCG CAU AAC UG-3'
   SER  GLY  MET  ALA  HIS   VAL  ALA   HIS  ASN .....

Completely different amino acid sequence after the methionine (MET). The stop codon is gone...the protein would continue being translated until it reaches another stop codon...so not what was supposed to be made! 
HIGH SCHOOL

Because minerals and vitamins have no energy value, they can be disregarded when calculating a day's total energy intake.

Answers

The statement above is TRUE.
They can be disregarded because they do not have energy value that they can contribute to the summation of the total daily intake. But this does not mean that they will not be taken in the diet.
 Although minerals and vitamins have no energy value, they are very important parts of balanced diet and a diet which lack these components can not be properly handle by the body, this is because, most times, these components are needed in the body for maximum utilization of the energy foods.
HIGH SCHOOL

Where are sperm cells stored after production?.

Answers

Sperms produced in the testes and are stored in the epididymis where they mature in order to be used. They are not stored in the seminal vesicles although that is where majority of ejaculation is produced.
In the testicles where they mature until ready to use
HIGH SCHOOL

To what class of minerals do gold silver and copper belong

Answers

The answer is native element mineral group
Rare Earth metals- gold and silver

Copper is just classified as a metal


HIGH SCHOOL

Are there any drawbacks to only regulating at the transcriptional level and not the translational level or protein level?

Answers

Yes, there are drawbacks to only regulating at the transcriptional level and not the translational level or protein level because it may lead to an inadequate amount of protein.

  • During gene transcription, a fragment of DNA known as 'gene' is used to produce a messenger RNA (mRNA).

  • Subsequently, this mRNA is used as a template to create a protein by a process called translation.

  • The interplay between transcriptional (DNA level) and posttranscriptional (mRNA level) levels is fundamental for regulating the exact amount of protein required for a cellular process.

In conclusion, there are drawbacks to only regulating at the transcriptional level and not the translational level or protein level because it may lead to an inadequate amount of protein.

Learn more in:

brainly.com/question/1048150

Ans.

Gene regulation or regulation of gene expression involves mechanisms, used by the cells to enhance or reduce the expression of specific genes to make proteins or RNA. Gene regulation occurs at transcriptional level and post-transcriptional level, which involves regulation at translational level or protein level.

Regulation at translational level or protein level is also important as regulation at transcriptional level. Translational regulation controls formation of proteins from mRNA molecules and includes non-coding mRNAs and repressor proteins. It is important for cell growth, differentiation and cellular response to stress and provides an immediate adjustment of gene expression  by directly regulating the protein concentration.

Regulation at protein level involves regulation of active protein. It includes regulation by various small molecules, post-translational modifications (such as phosphorylation), and proteolysis. Regulation only at transcriptional level is not sufficient to provide proper gene regulation and leads to various drawbacks, such as Fragile X Syndrome (due to defect in a protein).

Thus, 'gene regulation is important both at transcriptional level and at post-transcriptional level (during translation or protein level).'

COLLEGE

A group of scientists wants to determine whether a relationship exists between alcohol consumption and certain types of cancer. To this end, scientists provide study participants with a questionnaire asking them how many alcoholic drinks they have per week and what diseases they have (if any). These scientists provide subjects with a similar questionnaire annually (for a decade). These scientists are performing a(n) _____.

Answers

Answer: A group of scientists wants to determine whether a relationship exists between alcohol consumption and certain types of cancer. To this end, scientists provide study participants with a questionnaire asking them how many alcoholic drinks they have per week and what diseases they have (if any). These scientists provide subjects with a similar questionnaire annually (for a decade). These scientists are performing an ASSOCIATION STUDY.

Explanation: Association study is observational study in different individuals to see if a particular behavioral pattern (such as alcohol consumption) can be associated with certain type of disease (such as cancer).

Information collected from the questionnaires distributed will be subjected to statistical analysis and conclusion(s) will be made.

HIGH SCHOOL

Phase of the cell cycle in which the cell makes organelles needed for the new cell

Answers

Answer:

e

Explanation:

HIGH SCHOOL

What is an example of biological augmentation this is being used today?

Answers

The answer is an example of how bio augmentation has improved an environment, is in the coke plant wastewater in China. The process of adding cultured microorganisms into the subsurface for the purpose of biodegrading precise soil and groundwater contaminants is called Bio augmentation. 

fish and chips and salsa and chips and salsa and chips and salsa and chips and salsa and chips and salsa and chips and salsa and
MIDDLE SCHOOL

If a father is blood type A, and a mother is blood type B,what are all of the possible combinations that the offspring could be?

Answers

AA
AB
A0
BB
B0
00

^all the possible outcomes

A
AB
B
^basics

A, B, AB, and O are the basics.

While:
AA, AB, AO, BB, BO, and OO are possible outcomes.
Random Questions